Artie Ariel Bitcoin Dog - Mix of Grey Wolf, Shiba Inu, Border Collie, Corgi, Pitbull terrier and Dachshund

Achievements

None
Artie Ariel
I enjoy finding and eating frozen cat turds in the winter. Bon appétit! I'm going kill that damn Nyan Cat if I can catch it. Those Elizabethan cone collars are awful! You gotta lick when you gotta lick, am I right? I just want the simple things in life. A warm bed, a full food bowl, and a nice butt to sniff.
  • Purity 27%
  • Age 40 months
  • Racing Exp 0
  • Grey Wolf 55%
  • 0 races
  • Gen 9
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GTACCCCCCTACAGCCCCCCCTCCCCCCCCGGA
G
T
A
C
C
C
C
C
C
T
A
C
A
G
C
C
C
C
C
C
C
T
C
C
C
C
C
C
C
C
G
G
A
Genes: ELLJOLLNLLA

Composition

Grey Wolf
55%
Shiba Inu
9%
Border Collie
9%
Corgi
9%
Pitbull terrier
9%
Dachshund
9%

Current Energy

Vitality -34 points
Lunar Effect -18 points

Traits Breakdown

Body Shiba Inu
Tail Grey Wolf
Legs Grey Wolf
Front Legs Border Collie
Head Corgi
Ears Grey Wolf
Snout Grey Wolf
Mouth Pitbull terrier
Nose Grey Wolf
Eyes Grey Wolf
Color Dachshund