Uru Ursa Crypto Game Dog - Mix of German Shepard, Grey Wolf and Dachshund

Achievements

None
Uru Ursa
Pleased to meet you! My name's Uru Ursa. Too much steak gives me the runs! I'm not into dog collars, unless you're into S & M. My favorite sport is catching treats my human throws! As a perfectionist, I have to find just the right 'spot'.
  • Purity 40%
  • Age 26 months
  • Racing Exp 0
  • German Shepard 55%
  • 0 races
  • Gen 12
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCACCCTCATCATCACCCCCCCCCTCATCAGGA
T
C
A
C
C
C
T
C
A
T
C
A
T
C
A
C
C
C
C
C
C
C
C
C
T
C
A
T
C
A
G
G
A
Genes: 7L777LLL77A

Composition

German Shepard
55%
Grey Wolf
36%
Dachshund
9%

Current Energy

Vitality -11 points
Lunar Effect -14 points

Traits Breakdown

Body German Shepard
Tail Grey Wolf
Legs German Shepard
Front Legs German Shepard
Head German Shepard
Ears Grey Wolf
Snout Grey Wolf
Mouth Grey Wolf
Nose German Shepard
Eyes German Shepard
Color Dachshund