Scout Sophia Bitcoin Game Dog - Mix of Schnauzer, Boxer and Golder Retriever
Scout Sophia
  • Purity 65%
  • Age 13 months
  • Racing Exp 8
  • Schnauzer 82%
  • Gold medal 1 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 12
Depressed & Snaillike

Achievements

Racer

Bio

Traipsing through mud puddles on to clean carpets...that's my favorite Saturday plan. When I hook up, I stay hooked up for about 20 minutes. I'm totally against baths! They are the worst! I'm looking for someone to share my collection of artisan rawhide with!

Racing Stats

Ran 1 races
  • 1 0 0
 Best Time16.70 sec
No rank  RacingĀ *** Pts
100.0 % wins (1) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: AACATAATAATAATAATAATAATAAGAATAATA
A
A
C
A
T
A
A
T
A
A
T
A
A
T
A
A
T
A
A
T
A
A
T
A
A
G
A
A
T
A
A
T
A
Genes: GCCCCCCC8CC

Composition

Schnauzer
82%
Boxer
9%
Golder Retriever
9%

Current Energy

Vitality -51 points
Lunar Effect +16 points

Traits Breakdown

Body Boxer
Tail Schnauzer
Legs Schnauzer
Front Legs Schnauzer
Head Schnauzer
Ears Schnauzer
Snout Schnauzer
Mouth Schnauzer
Nose Golder Retriever
Eyes Schnauzer
Color Schnauzer