Scout Sophia Bitcoin Game Dog - Mix of Schnauzer, Boxer and Golder Retriever

Achievements

Racer
Scout Sophia
Traipsing through mud puddles on to clean carpets...that's my favorite Saturday plan. When I hook up, I stay hooked up for about 20 minutes. I'm totally against baths! They are the worst! I'm looking for someone to share my collection of artisan rawhide with!
  • Purity 65%
  • Age 22 months
  • Racing Exp 16
  • Schnauzer 82%
  • 4 races
  • Gen 12
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

4 races   |
  • 1 0 1
 Best Time16.70 sec
No rank  Racing *** Coins
50.0 % wins (2) Breeding *** Coins
Scheduled races 1 Total *** Coins

DNA Analysis

DNA Sequence: AACATAATAATAATAATAATAATAAGAATAATA
A
A
C
A
T
A
A
T
A
A
T
A
A
T
A
A
T
A
A
T
A
A
T
A
A
G
A
A
T
A
A
T
A
Genes: GCCCCCCC8CC

Composition

Schnauzer
82%
Boxer
9%
Golder Retriever
9%

Current Energy

Vitality -51 points
Lunar Effect -20 points

Traits Breakdown

Body Boxer
Tail Schnauzer
Legs Schnauzer
Front Legs Schnauzer
Head Schnauzer
Ears Schnauzer
Snout Schnauzer
Mouth Schnauzer
Nose Golder Retriever
Eyes Schnauzer
Color Schnauzer