Haunter Home Plate Cryptocurrency Dog - Mix of Schnauzer, Boxer, Pitbull terrier, St. Bernard and Golder Retriever
Haunter Home Plate
  • Purity 36%
  • Age 13 months
  • Racing Exp 15
  • Schnauzer 64%
  • Gold medal 0 Silver medal 0 Bronze medal 2
  • 5 races
  • Gen 11
Depressed & Snaillike

Achievements

Racer

Bio

I don't like having to stay off the furniture. Slipping my collar, running off and making my humans worried? Every chance I get. I cry whenever I hear an ambulance siren! When I can break free, I enjoy exploring my neighborhood without my human.

Racing Stats

Ran 5 races
  • 0 0 2
 Best Time16.02 sec
No rank  RacingĀ *** Pts
40.0 % wins (2) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: AACATAATAATATCCATATGAATAAGAATAATA
A
A
C
A
T
A
A
T
A
A
T
A
T
C
C
A
T
A
T
G
A
A
T
A
A
G
A
A
T
A
A
T
A
Genes: GCCCNCBC8CC

Composition

Schnauzer
64%
Boxer
9%
Pitbull terrier
9%
St. Bernard
9%
Golder Retriever
9%

Current Energy

Vitality -57 points
Lunar Effect +16 points

Traits Breakdown

Body Boxer
Tail Schnauzer
Legs Schnauzer
Front Legs Schnauzer
Head Pitbull terrier
Ears Schnauzer
Snout St. Bernard
Mouth Schnauzer
Nose Golder Retriever
Eyes Schnauzer
Color Schnauzer