Haunter Home Plate Cryptocurrency Dog - Mix of Schnauzer, Boxer, Pitbull terrier, St. Bernard and Golder Retriever

Achievements

Racer
Haunter Home Plate
I don't like having to stay off the furniture. Slipping my collar, running off and making my humans worried? Every chance I get. I cry whenever I hear an ambulance siren! When I can break free, I enjoy exploring my neighborhood without my human.
  • Purity 36%
  • Age 22 months
  • Racing Exp 25
  • Schnauzer 64%
  • 9 races
  • Gen 11
Make him happy share it to your friend*
Happy & Fast
Energy: ▂▃▅▆▇

Racing Stats

9 races   |
  • 0 1 2
 Best Time15.00 sec
Rank 90  Racing *** Coins
33.3 % wins (3) Breeding *** Coins
Scheduled races 1 Total *** Coins

DNA Analysis

DNA Sequence: AACATAATAATATCCATATGAATAAGAATAATA
A
A
C
A
T
A
A
T
A
A
T
A
T
C
C
A
T
A
T
G
A
A
T
A
A
G
A
A
T
A
A
T
A
Genes: GCCCNCBC8CC

Composition

Schnauzer
64%
Boxer
9%
Pitbull terrier
9%
St. Bernard
9%
Golder Retriever
9%

Current Energy

Vitality -57 points
Lunar Effect -20 points

Traits Breakdown

Body Boxer
Tail Schnauzer
Legs Schnauzer
Front Legs Schnauzer
Head Pitbull terrier
Ears Schnauzer
Snout St. Bernard
Mouth Schnauzer
Nose Golder Retriever
Eyes Schnauzer
Color Schnauzer