Sabrina Scrappy Cryptocurrency Game Dog - Mix of Schnauzer and Golder Retriever
Sabrina Scrappy
  • Purity 82%
  • Age 13 months
  • Racing Exp 1
  • Schnauzer 91%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 15
Depressed & Snaillike

Achievements

Racer

Bio

I'm Sabrina Scrappy. How goes it? As a digital dog, let me say Bob Dole did not invent the internet. I like big butts, I cannot lie. I get a little upset when my human gets mad at me for redecorating the house. It took me hours to spread all of that pillow stuffing out on the floor and I thought it looked perfect! I'm looking to share time together and not just to be an accessory.

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time17.22 sec
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: ATAATAATAATAATAATAATAATAAGAATAATA
A
T
A
A
T
A
A
T
A
A
T
A
A
T
A
A
T
A
A
T
A
A
T
A
A
G
A
A
T
A
A
T
A
Genes: CCCCCCCC8CC

Composition

Schnauzer
91%
Golder Retriever
9%

Current Energy

Vitality -62 points
Lunar Effect +18 points

Traits Breakdown

Body Schnauzer
Tail Schnauzer
Legs Schnauzer
Front Legs Schnauzer
Head Schnauzer
Ears Schnauzer
Snout Schnauzer
Mouth Schnauzer
Nose Golder Retriever
Eyes Schnauzer
Color Schnauzer

Parents

No Children

Photos

Gift