Sabrina Scrappy Cryptocurrency Game Dog - Mix of Schnauzer and Golder Retriever

Achievements

Racer
Sabrina Scrappy
I'm Sabrina Scrappy. How goes it? As a digital dog, let me say Bob Dole did not invent the internet. I like big butts, I cannot lie. I get a little upset when my human gets mad at me for redecorating the house. It took me hours to spread all of that pillow stuffing out on the floor and I thought it looked perfect! I'm looking to share time together and not just to be an accessory.
  • Purity 82%
  • Age 22 months
  • Racing Exp 4
  • Schnauzer 91%
  • 4 races
  • Gen 15
Make him happy share it to your friend*
Neutral & Agile
Energy: ▂▃▅▆▇

Racing Stats

4 races   |
  • 0 0 0
 Best Time16.37 sec
Rank 80  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 1 Total *** Coins

DNA Analysis

DNA Sequence: ATAATAATAATAATAATAATAATAAGAATAATA
A
T
A
A
T
A
A
T
A
A
T
A
A
T
A
A
T
A
A
T
A
A
T
A
A
G
A
A
T
A
A
T
A
Genes: CCCCCCCC8CC

Composition

Schnauzer
91%
Golder Retriever
9%

Current Energy

Vitality -62 points
Lunar Effect -22 points

Traits Breakdown

Body Schnauzer
Tail Schnauzer
Legs Schnauzer
Front Legs Schnauzer
Head Schnauzer
Ears Schnauzer
Snout Schnauzer
Mouth Schnauzer
Nose Golder Retriever
Eyes Schnauzer
Color Schnauzer