Jada Jaguar Litecoin Dog - Mix of Schnauzer and German Shepard

Achievements

Racer
Jada Jaguar
I run on the information superhighway and haven't been hit by a car yet. My favorite chews are underwear and rawhide...the rawhide lasts longer. I like to eat. Anything and everything. Old or new. My stomach doesn't discriminate! I'm not that picky. Wanna mate?
  • Purity 82%
  • Age 18 months
  • Racing Exp 46
  • Schnauzer 91%
  • 14 races
  • Gen 14
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

14 races   |
  • 0 2 4
 Best Time15.38 sec
Rank 69  Racing *** Pts
42.9 % wins (6) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ATAATAATAATAATATCAATAATAATAATAATA
A
T
A
A
T
A
A
T
A
A
T
A
A
T
A
T
C
A
A
T
A
A
T
A
A
T
A
A
T
A
A
T
A
Genes: CCCCC7CCCCC

Composition

Schnauzer
91%
German Shepard
9%

Current Energy

Vitality -68 points
Lunar Effect +22 points

Traits Breakdown

Body Schnauzer
Tail Schnauzer
Legs Schnauzer
Front Legs Schnauzer
Head Schnauzer
Ears German Shepard
Snout Schnauzer
Mouth Schnauzer
Nose Schnauzer
Eyes Schnauzer
Color Schnauzer