Jada Jaguar Litecoin Dog - Mix of Schnauzer and German Shepard
Jada Jaguar
  • Purity 82%
  • Age 13 months
  • Racing Exp 7
  • Schnauzer 91%
  • Gold medal 0 Silver medal 1 Bronze medal 0
  • 1 races
  • Gen 14
Depressed & Snaillike

Achievements

Racer

Bio

I run on the information superhighway and haven't been hit by a car yet. My favorite chews are underwear and rawhide...the rawhide lasts longer. I like to eat. Anything and everything. Old or new. My stomach doesn't discriminate! I'm not that picky. Wanna mate?

Racing Stats

Ran 1 races
  • 0 1 0
 Best Time15.38 sec
Rank 39  RacingĀ *** Pts
100.0 % wins (1) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: ATAATAATAATAATATCAATAATAATAATAATA
A
T
A
A
T
A
A
T
A
A
T
A
A
T
A
T
C
A
A
T
A
A
T
A
A
T
A
A
T
A
A
T
A
Genes: CCCCC7CCCCC

Composition

Schnauzer
91%
German Shepard
9%

Current Energy

Vitality -68 points
Lunar Effect -26 points

Traits Breakdown

Body Schnauzer
Tail Schnauzer
Legs Schnauzer
Front Legs Schnauzer
Head Schnauzer
Ears German Shepard
Snout Schnauzer
Mouth Schnauzer
Nose Schnauzer
Eyes Schnauzer
Color Schnauzer