Spark Spotty Cryptocurrency Dog - Mix of Schnauzer, German Shepard and Golder Retriever

Achievements

Racer
Spark Spotty
How do you do? I'm Spark Spotty. I love waking up early then indulging in long afternoon naps. You know the worst? Watching my humans 'get it on' when I've got no one. I cry whenever I hear an ambulance siren! What's your favorite bed? Mine is the dirty laundry.
  • Purity 65%
  • Age 21 months
  • Racing Exp 11
  • Schnauzer 82%
  • 6 races
  • Gen 13
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 1
6 races    Best Time16.47 sec
No rank  Racing *** Coins
16.7 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ATAATAATAATAATATCAATAATAAGAATAATA
A
T
A
A
T
A
A
T
A
A
T
A
A
T
A
T
C
A
A
T
A
A
T
A
A
G
A
A
T
A
A
T
A
Genes: CCCCC7CC8CC

Composition

Schnauzer
82%
German Shepard
9%
Golder Retriever
9%

Current Energy

Vitality -62 points
Lunar Effect -24 points

Traits Breakdown

Body Schnauzer
Tail Schnauzer
Legs Schnauzer
Front Legs Schnauzer
Head Schnauzer
Ears German Shepard
Snout Schnauzer
Mouth Schnauzer
Nose Golder Retriever
Eyes Schnauzer
Color Schnauzer