Spark Spotty Cryptocurrency Dog - Mix of Schnauzer, German Shepard and Golder Retriever
Spark Spotty
  • Purity 65%
  • Age 15 months
  • Racing Exp 1
  • Schnauzer 82%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 13
Depressed & Snaillike

Achievements

Racer

Bio

How do you do? I'm Spark Spotty. I love waking up early then indulging in long afternoon naps. You know the worst? Watching my humans 'get it on' when I've got no one. I cry whenever I hear an ambulance siren! What's your favorite bed? Mine is the dirty laundry.

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time17.32 sec
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: ATAATAATAATAATATCAATAATAAGAATAATA
A
T
A
A
T
A
A
T
A
A
T
A
A
T
A
T
C
A
A
T
A
A
T
A
A
G
A
A
T
A
A
T
A
Genes: CCCCC7CC8CC

Composition

Schnauzer
82%
German Shepard
9%
Golder Retriever
9%

Current Energy

Vitality -62 points
Lunar Effect -16 points

Traits Breakdown

Body Schnauzer
Tail Schnauzer
Legs Schnauzer
Front Legs Schnauzer
Head Schnauzer
Ears German Shepard
Snout Schnauzer
Mouth Schnauzer
Nose Golder Retriever
Eyes Schnauzer
Color Schnauzer