Astaroth Aigis Cryptocurrency Game Dog - Mix of Rottweiler, Beagle, Labrador, Pug, Corgi, Labrador BK, Pitbull terrier and St. Bernard
Astaroth Aigis
  • Purity 6%
  • Age 32 days
  • Racing Exp 0
  • Rottweiler 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 1
Sad & Slothful

Achievements

None

Bio

Hola! My name is Astaroth Aigis. Ima cyber dog. I have a crush on the Grumpy cat. I'm the best at running circle 8's. My favorite treat is to steal the pepperoni off of pizza. Shy dogs that tuck tail bore me.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CTACCACTACACGAAAGCCACGCATCCTGACAC
C
T
A
C
C
A
C
T
A
C
A
C
G
A
A
A
G
C
C
A
C
G
C
A
T
C
C
T
G
A
C
A
C
Genes: D5DH2OH6NBH

Composition

Rottweiler
27%
Beagle
18%
Labrador
9%
Pug
9%
Corgi
9%
Labrador BK
9%
Pitbull terrier
9%
St. Bernard
9%

Current Energy

Vitality +4 points
Lunar Effect 0 points

Traits Breakdown

Body Beagle
Tail Labrador
Legs Beagle
Front Legs Rottweiler
Head Pug
Ears Corgi
Snout Rottweiler
Mouth Labrador BK
Nose Pitbull terrier
Eyes St. Bernard
Color Rottweiler