Gouken Greta Crypto Dog - Mix of Golder Retriever, Rottweiler, Corgi, Border Collie, Labrador BK, Husky, German Shepard and Pitbull terrier

Achievements

None
Gouken Greta
Suh...you good? Gouken Greta here. I work hard all day as a data miner on the web, and that pawsitively irritating Nyan Cat doesn't work at all. Ever play 'catch' with two humans then it turns into 'keep away'? Hate that. I'll lick anything. I love car rides when I can stick my head out the window.
  • Purity 4%
  • Age 29 months
  • Racing Exp 0
  • Golder Retriever 18%
  • 0 races
  • Gen 0
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AGATACGCACACACAAGCTCAAGCTCCAGACAC
A
G
A
T
A
C
G
C
A
C
A
C
A
C
A
A
G
C
T
C
A
A
G
C
T
C
C
A
G
A
C
A
C
Genes: 8J6H4O7ON8H

Composition

Golder Retriever
18%
Rottweiler
18%
Corgi
18%
Border Collie
9%
Labrador BK
9%
Husky
9%
German Shepard
9%
Pitbull terrier
9%

Current Energy

Vitality -12 points
Lunar Effect -4 points

Traits Breakdown

Body Golder Retriever
Tail Border Collie
Legs Labrador BK
Front Legs Rottweiler
Head Husky
Ears Corgi
Snout German Shepard
Mouth Corgi
Nose Pitbull terrier
Eyes Golder Retriever
Color Rottweiler