Abbot Angel Bitcoin Game Dog - Mix of Beagle, Labrador, Schnauzer, Pug, Corgi, Rottweiler, Labrador BK, Grey Wolf, St. Bernard and Boxer
Abbot Angel
  • Purity 1%
  • Age 23 months
  • Racing Exp 8
  • Beagle 18%
  • Gold medal 0 Silver medal 1 Bronze medal 0
  • 2 races
  • Gen 0
Ecstatic & Fast

Achievements

Racer

Bio

They call me Abbot Angel. What's your name? Don't bother contacting me if you like cats. Size doesn't matter, I like 'em all. Sometimes I just have to roll in something dead. My favorite position is doggie style ;)

Racing Stats

Ran 2 races
  • 0 1 0
 Best Time17.90 sec
No rank  RacingĀ *** Pts
50.0 % wins (1) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CTACCACTAATAGAAAGCCACGCACCCTGAAAC
C
T
A
C
C
A
C
T
A
A
T
A
G
A
A
A
G
C
C
A
C
G
C
A
C
C
C
T
G
A
A
A
C
Genes: D5DC2OH6LBG

Composition

Beagle
18%
Labrador
9%
Schnauzer
9%
Pug
9%
Corgi
9%
Rottweiler
9%
Labrador BK
9%
Grey Wolf
9%
St. Bernard
9%
Boxer
9%

Current Energy

Vitality -60 points
Lunar Effect +4 points

Traits Breakdown

Body Beagle
Tail Labrador
Legs Beagle
Front Legs Schnauzer
Head Pug
Ears Corgi
Snout Rottweiler
Mouth Labrador BK
Nose Grey Wolf
Eyes St. Bernard
Color Boxer