Abbot Angel Bitcoin Game Dog - Mix of Beagle, Labrador, Schnauzer, Pug, Corgi, Rottweiler, Labrador BK, Grey Wolf, St. Bernard and Boxer

Achievements

None
Abbot Angel
They call me Abbot Angel. What's your name? Don't bother contacting me if you like cats. Size doesn't matter, I like 'em all. Sometimes I just have to roll in something dead. My favorite position is doggie style ;)
  • Purity 1%
  • Age 26 months
  • Racing Exp 0
  • Beagle 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CTACCACTAATAGAAAGCCACGCACCCTGAAAC
C
T
A
C
C
A
C
T
A
A
T
A
G
A
A
A
G
C
C
A
C
G
C
A
C
C
C
T
G
A
A
A
C
Genes: D5DC2OH6LBG

Composition

Beagle
18%
Labrador
9%
Schnauzer
9%
Pug
9%
Corgi
9%
Rottweiler
9%
Labrador BK
9%
Grey Wolf
9%
St. Bernard
9%
Boxer
9%

Current Energy

Vitality -60 points
Lunar Effect +4 points

Traits Breakdown

Body Beagle
Tail Labrador
Legs Beagle
Front Legs Schnauzer
Head Pug
Ears Corgi
Snout Rottweiler
Mouth Labrador BK
Nose Grey Wolf
Eyes St. Bernard
Color Boxer