Bud Butter Digital Cryptocurrency Game Dog - Mix of Rottweiler, Labrador, Labrador BK, Maltese, Poodle, Grey Wolf, Yorkshire Terrier and Husky

Achievements

Racer
Bud Butter
This dawg chases mice in a big data warehouse. It turns me on when I can show an older dog a new trick. Removing excess stuffing from pillows is my favorite hobby. Watching kids play without me is the worst, no? I'm looking to share time together and not just to be an accessory.
  • Purity 6%
  • Age 21 months
  • Racing Exp 14
  • Rottweiler 18%
  • 7 races
  • Gen 1
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 1 0 0
7 races    Best Time15.87 sec
No rank  Racing *** Coins
14.3 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACACCCCAGCAGCACCACACGACCCCTTAACA
C
A
C
A
C
C
C
C
A
G
C
A
G
C
A
C
C
A
C
A
C
G
A
C
C
C
C
T
T
A
A
C
A
Genes: HK5665HILF4

Composition

Rottweiler
18%
Labrador
18%
Labrador BK
18%
Maltese
9%
Poodle
9%
Grey Wolf
9%
Yorkshire Terrier
9%
Husky
9%

Current Energy

Vitality -21 points
Lunar Effect -20 points

Traits Breakdown

Body Rottweiler
Tail Maltese
Legs Labrador
Front Legs Labrador BK
Head Labrador BK
Ears Labrador
Snout Rottweiler
Mouth Poodle
Nose Grey Wolf
Eyes Yorkshire Terrier
Color Husky