Bud Butter Digital Cryptocurrency Game Dog - Mix of Rottweiler, Labrador, Labrador BK, Maltese, Poodle, Grey Wolf, Yorkshire Terrier and Husky

Achievements

Racer
Podium Champion
Bud Butter
This dawg chases mice in a big data warehouse. It turns me on when I can show an older dog a new trick. Removing excess stuffing from pillows is my favorite hobby. Watching kids play without me is the worst, no? I'm looking to share time together and not just to be an accessory.
  • Purity 6%
  • Age 18 months
  • Racing Exp 49
  • Rottweiler 18%
  • 17 races
  • Gen 1
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

17 races   |
  • 3 1 1
 Best Time16.12 sec
No rank  Racing *** Pts
29.4 % wins (5) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CACACCCCAGCAGCACCACACGACCCCTTAACA
C
A
C
A
C
C
C
C
A
G
C
A
G
C
A
C
C
A
C
A
C
G
A
C
C
C
C
T
T
A
A
C
A
Genes: HK5665HILF4

Composition

Rottweiler
18%
Labrador
18%
Labrador BK
18%
Maltese
9%
Poodle
9%
Grey Wolf
9%
Yorkshire Terrier
9%
Husky
9%

Current Energy

Vitality -21 points
Lunar Effect +4 points

Traits Breakdown

Body Rottweiler
Tail Maltese
Legs Labrador
Front Legs Labrador BK
Head Labrador BK
Ears Labrador
Snout Rottweiler
Mouth Poodle
Nose Grey Wolf
Eyes Yorkshire Terrier
Color Husky

Parents

No Children

Photos

online dog race results crypto doggy race crypto pet racing Bitcoin dog race virtual canine race