Bud Butter Digital Cryptocurrency Game Dog - Mix of Rottweiler, Labrador, Labrador BK, Maltese, Poodle, Grey Wolf, Yorkshire Terrier and Husky
Bud Butter
  • Purity 6%
  • Age 13 months
  • Racing Exp 10
  • Rottweiler 18%
  • Gold medal 1 Silver medal 0 Bronze medal 0
  • 3 races
  • Gen 1
Depressed & Snaillike

Achievements

Racer

Bio

This dawg chases mice in a big data warehouse. It turns me on when I can show an older dog a new trick. Removing excess stuffing from pillows is my favorite hobby. Watching kids play without me is the worst, no? I'm looking to share time together and not just to be an accessory.

Racing Stats

Ran 3 races
  • 1 0 0
 Best Time16.18 sec
No rank  RacingĀ *** Pts
33.3 % wins (1) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CACACCCCAGCAGCACCACACGACCCCTTAACA
C
A
C
A
C
C
C
C
A
G
C
A
G
C
A
C
C
A
C
A
C
G
A
C
C
C
C
T
T
A
A
C
A
Genes: HK5665HILF4

Composition

Rottweiler
18%
Labrador
18%
Labrador BK
18%
Maltese
9%
Poodle
9%
Grey Wolf
9%
Yorkshire Terrier
9%
Husky
9%

Current Energy

Vitality -21 points
Lunar Effect +6 points

Traits Breakdown

Body Rottweiler
Tail Maltese
Legs Labrador
Front Legs Labrador BK
Head Labrador BK
Ears Labrador
Snout Rottweiler
Mouth Poodle
Nose Grey Wolf
Eyes Yorkshire Terrier
Color Husky

Parents

No Children

Photos

online dog racing
Gift