Callisto Chase Bitcoin Dog - Mix of Labrador, Grey Wolf, German Shepard, Maltese, St. Bernard, Rottweiler, Boxer, Dachshund and Husky
Callisto Chase
  • Purity 3%
  • Age 32 months
  • Racing Exp 22
  • Labrador 18%
  • Gold medal 1 Silver medal 1 Bronze medal 0
  • 9 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

It's a barkin' beautiful day! Callisto Chase here. I live inside of a Virtual machine two steps to the right from the firewall. I love licking faces! Little humans are my favorite because they usually have some good food smeared all over them! Fun-loving and playful only need apply.

Racing Stats

Ran 9 races
  • 1 1 0
 Best Time14.67 sec
No rank  RacingĀ *** Pts
22.2 % wins (2) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TCAACCCCACCCTGACCACACAACCCCGGAACA
T
C
A
A
C
C
C
C
A
C
C
C
T
G
A
C
C
A
C
A
C
A
A
C
C
C
C
G
G
A
A
C
A
Genes: 7K5LB5HGLA4

Composition

Labrador
18%
Grey Wolf
18%
German Shepard
9%
Maltese
9%
St. Bernard
9%
Rottweiler
9%
Boxer
9%
Dachshund
9%
Husky
9%

Current Energy

Vitality -6 points
Lunar Effect -2 points

Traits Breakdown

Body German Shepard
Tail Maltese
Legs Labrador
Front Legs Grey Wolf
Head St. Bernard
Ears Labrador
Snout Rottweiler
Mouth Boxer
Nose Grey Wolf
Eyes Dachshund
Color Husky