Robin Hood Raison Cryptocurrency Dog - Mix of Yorkshire Terrier, Labrador, German Shepard, St. Bernard, Rottweiler, Pitbull terrier and Maltese
Robin Hood Raison
  • Purity 10%
  • Age 17 months
  • Racing Exp 0
  • Yorkshire Terrier 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 1
Depressed & Snaillike

Achievements

None

Bio

Hello there, my name is Robin Hood Raison. I love hiding my human's shoes. I have a pretty nice collection of old, stinky sneakers. I've had my nose rubbed in 'it' more than once. I want a friend to poop with me in my neighbor's yard, just to watch him turn all shades of red.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TCATTACCATTATGACCACACTTATCCACCTTA
T
C
A
T
T
A
C
C
A
T
T
A
T
G
A
C
C
A
C
A
C
T
T
A
T
C
C
A
C
C
T
T
A
Genes: 7F5FB5HFNKF

Composition

Yorkshire Terrier
36%
Labrador
18%
German Shepard
9%
St. Bernard
9%
Rottweiler
9%
Pitbull terrier
9%
Maltese
9%

Current Energy

Vitality -21 points
Lunar Effect 0 points

Traits Breakdown

Body German Shepard
Tail Yorkshire Terrier
Legs Labrador
Front Legs Yorkshire Terrier
Head St. Bernard
Ears Labrador
Snout Rottweiler
Mouth Yorkshire Terrier
Nose Pitbull terrier
Eyes Maltese
Color Yorkshire Terrier