Julia Jellybean Litecoin Game Dog - Mix of Poodle, Labrador BK, Rottweiler, Dachshund and Yorkshire Terrier

Achievements

Racer
Podium Champion
Julia Jellybean
Hi! I'm Julia Jellybean! In my digital world, cats aren't the only ones who hack. Eat, sleep, poop. Honey, I've got it made. My female human wears crotchless undies, but she doesn't like the ones I make for her! I enjoy trying to be friends with the neighbor's cats. They still run away from me but they'll grow to love me one day!
  • Purity 22%
  • Age 18 months
  • Racing Exp 64
  • Poodle 36%
  • 24 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

24 races   |
  • 1 3 3
 Best Time15.25 sec
No rank  Racing *** Pts
29.2 % wins (7) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CACGGAGCAGCAGCAGACGACGACCACTTAGAC
C
A
C
G
G
A
G
C
A
G
C
A
G
C
A
G
A
C
G
A
C
G
A
C
C
A
C
T
T
A
G
A
C
Genes: HA666IIIHFI

Composition

Poodle
36%
Labrador BK
27%
Rottweiler
18%
Dachshund
9%
Yorkshire Terrier
9%

Current Energy

Vitality -21 points
Lunar Effect +10 points

Traits Breakdown

Body Rottweiler
Tail Dachshund
Legs Labrador BK
Front Legs Labrador BK
Head Labrador BK
Ears Poodle
Snout Poodle
Mouth Poodle
Nose Rottweiler
Eyes Yorkshire Terrier
Color Poodle

Parents

Children

Photos

crypto doggy racing virtual pet race virtual doggy race virtual canine race results crypto canine race Bitcoin canine race cryptocurrency dog race photo