Tiny Tara Bitcoin Dog - Mix of Rottweiler, Grey Wolf, Labrador, Labrador BK, St. Bernard, Shiba Inu, Border Collie and Yorkshire Terrier
Tiny Tara
  • Purity 11%
  • Age 17 months
  • Racing Exp 41
  • Rottweiler 36%
  • Gold medal 2 Silver medal 2 Bronze medal 1
  • 10 races
  • Gen 0
Depressed & Snaillike

Achievements

Podium Champion
Pro Racer

Bio

How you doin? ;) Tiny Tara here. My idea of romance would be to stroll through in the dog park then share a meaty bone with you. I love digging. No particular reason, it just satisfies me to make a huge, muddy mess wherever I go. I just want the simple things in life. A warm bed, a full food bowl, and a nice butt to sniff.

Racing Stats

Ran 10 races
  • 2 2 1
 Best Time15.27 sec
No rank  RacingĀ *** Pts
50.0 % wins (5) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CCCCACCACCCACACGCATGACACGTATACTTA
C
C
C
C
A
C
C
A
C
C
C
A
C
A
C
G
C
A
T
G
A
C
A
C
G
T
A
T
A
C
T
T
A
Genes: LHH5H6BHEJF

Composition

Rottweiler
36%
Grey Wolf
9%
Labrador
9%
Labrador BK
9%
St. Bernard
9%
Shiba Inu
9%
Border Collie
9%
Yorkshire Terrier
9%

Current Energy

Vitality -4 points
Lunar Effect -8 points

Traits Breakdown

Body Grey Wolf
Tail Rottweiler
Legs Rottweiler
Front Legs Labrador
Head Rottweiler
Ears Labrador BK
Snout St. Bernard
Mouth Rottweiler
Nose Shiba Inu
Eyes Border Collie
Color Yorkshire Terrier