Tiny Tara Bitcoin Dog - Mix of Rottweiler, Grey Wolf, Labrador, Labrador BK, St. Bernard, Shiba Inu, Border Collie and Yorkshire Terrier

Achievements

Racer
Tiny Tara
How you doin? ;) Tiny Tara here. My idea of romance would be to stroll through in the dog park then share a meaty bone with you. I love digging. No particular reason, it just satisfies me to make a huge, muddy mess wherever I go. I just want the simple things in life. A warm bed, a full food bowl, and a nice butt to sniff.
  • Purity 11%
  • Age 20 months
  • Racing Exp 16
  • Rottweiler 36%
  • 3 races
  • Gen 0
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 1 1 0
3 races    Best Time15.27 sec
No rank  Racing *** Coins
66.7 % wins (2) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCCCACCACCCACACGCATGACACGTATACTTA
C
C
C
C
A
C
C
A
C
C
C
A
C
A
C
G
C
A
T
G
A
C
A
C
G
T
A
T
A
C
T
T
A
Genes: LHH5H6BHEJF

Composition

Rottweiler
36%
Grey Wolf
9%
Labrador
9%
Labrador BK
9%
St. Bernard
9%
Shiba Inu
9%
Border Collie
9%
Yorkshire Terrier
9%

Current Energy

Vitality -4 points
Lunar Effect 0 points

Traits Breakdown

Body Grey Wolf
Tail Rottweiler
Legs Rottweiler
Front Legs Labrador
Head Rottweiler
Ears Labrador BK
Snout St. Bernard
Mouth Rottweiler
Nose Shiba Inu
Eyes Border Collie
Color Yorkshire Terrier