Sox Simon Bitcoin Game Dog - Mix of Rottweiler, Pug, Labrador, St. Bernard, Maltese and Yorkshire Terrier
Sox Simon
  • Purity 15%
  • Age 17 months
  • Racing Exp 16
  • Rottweiler 36%
  • Gold medal 0 Silver medal 1 Bronze medal 0
  • 10 races
  • Gen 2
Depressed & Snaillike

Achievements

Racer

Bio

Hey! Call me Sox Simon. Creativity is my middle name... I turn everything in to a chew toy. Peanut butter is delish but I HATE when it sticks to the roof of my mouth. Too much steak gives me the runs! If you are tall enough to reach the door handle, I 'specially wanna meet you.

Racing Stats

Ran 10 races
  • 0 1 0
 Best Time15.70 sec
Rank 65  RacingĀ *** Pts
10.0 % wins (1) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GAACACCACCCACACGAATGACACACCGAATTA
G
A
A
C
A
C
C
A
C
C
C
A
C
A
C
G
A
A
T
G
A
C
A
C
A
C
C
G
A
A
T
T
A
Genes: 2HH5H2BHK2F

Composition

Rottweiler
36%
Pug
27%
Labrador
9%
St. Bernard
9%
Maltese
9%
Yorkshire Terrier
9%

Current Energy

Vitality -36 points
Lunar Effect 0 points

Traits Breakdown

Body Pug
Tail Rottweiler
Legs Rottweiler
Front Legs Labrador
Head Rottweiler
Ears Pug
Snout St. Bernard
Mouth Rottweiler
Nose Maltese
Eyes Pug
Color Yorkshire Terrier

Parents

No Children

Photos

virtual pet race
Gift