Sox Simon Bitcoin Game Dog - Mix of Rottweiler, Pug, Labrador, St. Bernard, Maltese and Yorkshire Terrier

Achievements

Racer
Sox Simon
Hey! Call me Sox Simon. Creativity is my middle name... I turn everything in to a chew toy. Peanut butter is delish but I HATE when it sticks to the roof of my mouth. Too much steak gives me the runs! If you are tall enough to reach the door handle, I 'specially wanna meet you.
  • Purity 15%
  • Age 21 months
  • Racing Exp 3
  • Rottweiler 36%
  • 3 races
  • Gen 2
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
3 races    Best Time15.70 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GAACACCACCCACACGAATGACACACCGAATTA
G
A
A
C
A
C
C
A
C
C
C
A
C
A
C
G
A
A
T
G
A
C
A
C
A
C
C
G
A
A
T
T
A
Genes: 2HH5H2BHK2F

Composition

Rottweiler
36%
Pug
27%
Labrador
9%
St. Bernard
9%
Maltese
9%
Yorkshire Terrier
9%

Current Energy

Vitality -36 points
Lunar Effect +2 points

Traits Breakdown

Body Pug
Tail Rottweiler
Legs Rottweiler
Front Legs Labrador
Head Rottweiler
Ears Pug
Snout St. Bernard
Mouth Rottweiler
Nose Maltese
Eyes Pug
Color Yorkshire Terrier