Bacchus Balrog Bitcoin Game Dog - Mix of Rottweiler, Labrador BK, Labrador, Beagle, Corgi, Pitbull terrier, Border Collie and Dachshund

Achievements

Racer
Bacchus Balrog
Barkjour mi amor! I'm Bacchus Balrog. I'm a little said right now because my friend just got hit trying to dodge heavy web traffic. I enjoy staying active, and running circles around puppies and young children. Small yappy creatures bug me...they disturb my zen.
  • Purity 11%
  • Age 20 months
  • Racing Exp 22
  • Rottweiler 36%
  • 3 races
  • Gen 1
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 2 0 1
3 races    Best Time15.17 sec
No rank  Racing *** Coins
100.0 % wins (3) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCACACCACCCACACCTAAGCCACTCCTACGGA
G
C
A
C
A
C
C
A
C
C
C
A
C
A
C
C
T
A
A
G
C
C
A
C
T
C
C
T
A
C
G
G
A
Genes: 6HH5HDOHNJA

Composition

Rottweiler
36%
Labrador BK
9%
Labrador
9%
Beagle
9%
Corgi
9%
Pitbull terrier
9%
Border Collie
9%
Dachshund
9%

Current Energy

Vitality -7 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador BK
Tail Rottweiler
Legs Rottweiler
Front Legs Labrador
Head Rottweiler
Ears Beagle
Snout Corgi
Mouth Rottweiler
Nose Pitbull terrier
Eyes Border Collie
Color Dachshund

Parents

No Children

Photos

crypto pet race virtual canine racing podium Litecoin dog racing results crypto dog race photo Litecoin pet racing