Bacchus Balrog Bitcoin Game Dog - Mix of Rottweiler, Labrador BK, Labrador, Beagle, Corgi, Pitbull terrier, Border Collie and Dachshund
Bacchus Balrog
  • Purity 11%
  • Age 13 months
  • Racing Exp 22
  • Rottweiler 36%
  • Gold medal 2 Silver medal 0 Bronze medal 1
  • 3 races
  • Gen 1
Depressed & Snaillike

Achievements

Racer

Bio

Barkjour mi amor! I'm Bacchus Balrog. I'm a little said right now because my friend just got hit trying to dodge heavy web traffic. I enjoy staying active, and running circles around puppies and young children. Small yappy creatures bug me...they disturb my zen.

Racing Stats

Ran 3 races
  • 2 0 1
 Best Time15.17 sec
Rank 28  RacingĀ *** Pts
100.0 % wins (3) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GCACACCACCCACACCTAAGCCACTCCTACGGA
G
C
A
C
A
C
C
A
C
C
C
A
C
A
C
C
T
A
A
G
C
C
A
C
T
C
C
T
A
C
G
G
A
Genes: 6HH5HDOHNJA

Composition

Rottweiler
36%
Labrador BK
9%
Labrador
9%
Beagle
9%
Corgi
9%
Pitbull terrier
9%
Border Collie
9%
Dachshund
9%

Current Energy

Vitality -7 points
Lunar Effect -4 points

Traits Breakdown

Body Labrador BK
Tail Rottweiler
Legs Rottweiler
Front Legs Labrador
Head Rottweiler
Ears Beagle
Snout Corgi
Mouth Rottweiler
Nose Pitbull terrier
Eyes Border Collie
Color Dachshund

Parents

No Children

Photos

cryptocurrency pet racing cryptocurrency dog racing cryptocurrency canine race
Gift