Endzone Elena Bitcoin Game Dog - Mix of Maltese, Beagle, Labrador, Rottweiler, Husky, Grey Wolf and Border Collie

Achievements

Racer
Endzone Elena
My humans say I bark too much, but I have a lot to say! My idea of romance would be to stroll through in the dog park then share a meaty bone with you. I like to play fetch with a tennis ball. Aggressive dogs that don't let 'me be me' frustrate me.
  • Purity 16%
  • Age 41 months
  • Racing Exp 8
  • Maltese 45%
  • 2 races
  • Gen 1
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 1 0
2 races    Best Time15.87 sec
No rank  Racing *** Coins
50.0 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CTAACCCCAACCCACACCACACCCACCACCTAC
C
T
A
A
C
C
C
C
A
A
C
C
C
A
C
A
C
C
A
C
A
C
C
C
A
C
C
A
C
C
T
A
C
Genes: DK5KHK4LKKJ

Composition

Maltese
45%
Beagle
9%
Labrador
9%
Rottweiler
9%
Husky
9%
Grey Wolf
9%
Border Collie
9%

Current Energy

Vitality -46 points
Lunar Effect +8 points

Traits Breakdown

Body Beagle
Tail Maltese
Legs Labrador
Front Legs Maltese
Head Rottweiler
Ears Maltese
Snout Husky
Mouth Grey Wolf
Nose Maltese
Eyes Maltese
Color Border Collie