Digby Darwin Litecoin Dog - Mix of Maltese, Beagle, Labrador, Rottweiler, Husky, Schnauzer, Boxer, Dachshund and Border Collie

Achievements

Racer
Digby Darwin
Salutations! My name's Digby Darwin. I run on the information superhighway and haven't been hit by a car yet. I prefer lounging around the house. Nothing beats the midday sunbeam on the couch! I hate it when humans put the lid down. When my human brushes my coat, I get frisky!
  • Purity 4%
  • Age 38 months
  • Racing Exp 8
  • Maltese 27%
  • 2 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 0 1 0
 Best Time15.08 sec
No rank  Racing *** Pts
50.0 % wins (1) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CTAACCCCAACCCACACCACAATAAACGGATAC
C
T
A
A
C
C
C
C
A
A
C
C
C
A
C
A
C
C
A
C
A
A
T
A
A
A
C
G
G
A
T
A
C
Genes: DK5KHK4CGAJ

Composition

Maltese
27%
Beagle
9%
Labrador
9%
Rottweiler
9%
Husky
9%
Schnauzer
9%
Boxer
9%
Dachshund
9%
Border Collie
9%

Current Energy

Vitality -46 points
Lunar Effect -4 points

Traits Breakdown

Body Beagle
Tail Maltese
Legs Labrador
Front Legs Maltese
Head Rottweiler
Ears Maltese
Snout Husky
Mouth Schnauzer
Nose Boxer
Eyes Dachshund
Color Border Collie