Cutie-Pie Chipper Digital Cryptocurrency Dog - Mix of Maltese, Husky, Grey Wolf, Pug, Border Collie, Golder Retriever and French Bulldog

Achievements

Racer
Cutie-Pie Chipper
How goes it? I'm Cutie-Pie Chipper. I'm all about a hard drive because you can't do anything with a floppy disc. Once I caught a seagull, but it scared me so I let it go. I like it when you're frisky. My human is my best friend, looking for someone who is okay with that.
  • Purity 9%
  • Age 40 months
  • Racing Exp 8
  • Maltese 27%
  • 2 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 1 0
2 races    Best Time15.70 sec
No rank  Racing *** Coins
50.0 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACCACAGAACCCACATACAGACCCACCACCCGA
A
C
C
A
C
A
G
A
A
C
C
C
A
C
A
T
A
C
A
G
A
C
C
C
A
C
C
A
C
C
C
G
A
Genes: K42L4J8LKK9

Composition

Maltese
27%
Husky
18%
Grey Wolf
18%
Pug
9%
Border Collie
9%
Golder Retriever
9%
French Bulldog
9%

Current Energy

Vitality -45 points
Lunar Effect -6 points

Traits Breakdown

Body Maltese
Tail Husky
Legs Pug
Front Legs Grey Wolf
Head Husky
Ears Border Collie
Snout Golder Retriever
Mouth Grey Wolf
Nose Maltese
Eyes Maltese
Color French Bulldog