Brunhilda Barrel Digital Cryptocurrency Dog - Mix of Husky, French Bulldog, Labrador, Grey Wolf, Boxer, Schnauzer, Golder Retriever, Border Collie and Yorkshire Terrier

Achievements

Racer
Brunhilda Barrel
Good day to you! I'm Brunhilda Barrel! You'll find me walking into my favorite pet store like I own the place. I do, don't I? I think hamsters and cats are both over-rated. I really enjoy squeaky toys! Well, I like ripping them apart and taking out the squeaker!
  • Purity 5%
  • Age 43 months
  • Racing Exp 17
  • Husky 18%
  • 7 races
  • Gen 0
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

7 races   |
  • 0 0 2
 Best Time16.30 sec
Rank 99  Racing *** Coins
28.6 % wins (2) Breeding *** Coins
Scheduled races 1 Total *** Coins

DNA Analysis

DNA Sequence: ACACCACCCAACACAATAAGATACCGACGATTA
A
C
A
C
C
A
C
C
C
A
A
C
A
C
A
A
T
A
A
G
A
T
A
C
C
G
A
C
G
A
T
T
A
Genes: 45LG4C8J99F

Composition

Husky
18%
French Bulldog
18%
Labrador
9%
Grey Wolf
9%
Boxer
9%
Schnauzer
9%
Golder Retriever
9%
Border Collie
9%
Yorkshire Terrier
9%

Current Energy

Vitality -15 points
Lunar Effect -8 points

Traits Breakdown

Body Husky
Tail Labrador
Legs Grey Wolf
Front Legs Boxer
Head Husky
Ears Schnauzer
Snout Golder Retriever
Mouth Border Collie
Nose French Bulldog
Eyes French Bulldog
Color Yorkshire Terrier