Ebony Emmitt Litecoin Dog - Mix of Husky and French Bulldog

Achievements

None
Ebony Emmitt
Grumpy Cat's grumpy because she knows virtual dogs like me are better than internet cat sensations. My favorite game is Fetch except I never bring the ball back. I prefer lounging around the house. Nothing beats the midday sunbeam on the couch! My humans say I bark too much, but I have a lot to say!
  • Purity 82%
  • Age 38 months
  • Racing Exp 0
  • Husky 91%
  • 0 races
  • Gen 8
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACAACAACAACAACAACAACAACACGAACAACA
A
C
A
A
C
A
A
C
A
A
C
A
A
C
A
A
C
A
A
C
A
A
C
A
C
G
A
A
C
A
A
C
A
Genes: 44444444944

Composition

Husky
91%
French Bulldog
9%

Current Energy

Vitality -6 points
Lunar Effect -4 points

Traits Breakdown

Body Husky
Tail Husky
Legs Husky
Front Legs Husky
Head Husky
Ears Husky
Snout Husky
Mouth Husky
Nose French Bulldog
Eyes Husky
Color Husky