Schotzie Sailor Crypto Dog - Mix of Schnauzer, Beagle, Border Collie, Pitbull terrier and Golder Retriever
Schotzie Sailor
  • Purity 31%
  • Age 51 months
  • Racing Exp 16
  • Schnauzer 55%
  • Gold medal 1 Silver medal 0 Bronze medal 0
  • 9 races
  • Gen 11
Depressed & Snaillike

Achievements

Racer

Bio

My name is Schotzie Sailor and I do tricks. Baby, I'm made from the same stuff as dreams. Small yappy creatures bug me...they disturb my zen. I may need de-worming. Forget plastic hotdogs...I'm into the classic chew toys like slippers. I'm hoping to find someone who'll howl at the moon with me.

Racing Stats

Ran 9 races
  • 1 0 0
 Best Time16.13 sec
No rank  RacingĀ *** Pts
11.1% wins (1) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: ATAATAATAATACTAATAATATACTCCAGACTA
A
T
A
A
T
A
A
T
A
A
T
A
C
T
A
A
T
A
A
T
A
T
A
C
T
C
C
A
G
A
C
T
A
Genes: CCCCDCCJN8D

Composition

Schnauzer
55%
Beagle
18%
Border Collie
9%
Pitbull terrier
9%
Golder Retriever
9%

Current Energy

Vitality -62 points
Lunar Effect +14 points

Traits Breakdown

Body Schnauzer
Tail Schnauzer
Legs Schnauzer
Front Legs Schnauzer
Head Beagle
Ears Schnauzer
Snout Schnauzer
Mouth Border Collie
Nose Pitbull terrier
Eyes Golder Retriever
Color Beagle