Picasso Pepper Litecoin Dog - Mix of Schnauzer, Beagle, St. Bernard, Labrador, Dachshund, Border Collie, Pitbull terrier and Golder Retriever

Achievements

Racer
Picasso Pepper
I love waking up early then indulging in long afternoon naps. Man, I hate it when my humans run out of my favorite food so all I get is 'dry' stuff. Squeaky toys are the best, don't you agree? Trust me. Leashes, collar and whips can be fun if you know what you're doing.
  • Purity 8%
  • Age 18 months
  • Racing Exp 75
  • Schnauzer 27%
  • 26 races
  • Gen 0
Share it to make him Happy!
Neutral & Lazy
Energy: ▂▃▅▆▇

Racing Stats

26 races   |
  • 0 4 5
 Best Time14.93 sec
No rank  Racing *** Pts
34.6 % wins (9) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ATATGAATAATACTACCAGGATACTCCAGACTA
A
T
A
T
G
A
A
T
A
A
T
A
C
T
A
C
C
A
G
G
A
T
A
C
T
C
C
A
G
A
C
T
A
Genes: CBCCD5AJN8D

Composition

Schnauzer
27%
Beagle
18%
St. Bernard
9%
Labrador
9%
Dachshund
9%
Border Collie
9%
Pitbull terrier
9%
Golder Retriever
9%

Current Energy

Vitality -65 points
Lunar Effect -16 points

Traits Breakdown

Body Schnauzer
Tail St. Bernard
Legs Schnauzer
Front Legs Schnauzer
Head Beagle
Ears Labrador
Snout Dachshund
Mouth Border Collie
Nose Pitbull terrier
Eyes Golder Retriever
Color Beagle