Biggie Boba Fett Cryptocurrency Dog - Mix of Golder Retriever, Husky, Pitbull terrier, Border Collie, Labrador, Shiba Inu and Rottweiler

Achievements

None
Biggie Boba Fett
It's a barkin' beautiful day! Biggie Boba Fett here. I'm always up for a nice long walk around the neighborhood. I need laid otherwise I'm going to start agreeing with Grumpy Cat. I'm terrified of the big, loud, metal creature with people inside that picks up the trash every week. It's really scary!
  • Purity 12%
  • Age 26 months
  • Racing Exp 0
  • Golder Retriever 36%
  • 0 races
  • Gen 4
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCCAGAACATACAGACCAGTAACACACAGAAGA
T
C
C
A
G
A
A
C
A
T
A
C
A
G
A
C
C
A
G
T
A
A
C
A
C
A
C
A
G
A
A
G
A
Genes: N84J85E4H88

Composition

Golder Retriever
36%
Husky
18%
Pitbull terrier
9%
Border Collie
9%
Labrador
9%
Shiba Inu
9%
Rottweiler
9%

Current Energy

Vitality -34 points
Lunar Effect -10 points

Traits Breakdown

Body Pitbull terrier
Tail Golder Retriever
Legs Husky
Front Legs Border Collie
Head Golder Retriever
Ears Labrador
Snout Shiba Inu
Mouth Husky
Nose Rottweiler
Eyes Golder Retriever
Color Golder Retriever