Mowgli Moana Bitcoin Game Dog - Mix of Pitbull terrier, Border Collie, French Bulldog, Corgi, Labrador BK, Shiba Inu, Husky, German Shepard and St. Bernard

Achievements

None
Mowgli Moana
Suh? How's it goin? I'm Mowgli Moana. I live behind a firewall in the Machine. I never knew my father. I like to smell everything, but my favorite smell is freshly cut grass. I like to roll in it until my fur turns green! I just want to share a ball with someone, if you know what I mean...
  • Purity 5%
  • Age 41 months
  • Racing Exp 0
  • Pitbull terrier 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCCCGAAGCTACTACGCAGTAACATCATCCTGA
T
C
C
C
G
A
A
G
C
T
A
C
T
A
C
G
C
A
G
T
A
A
C
A
T
C
A
T
C
C
T
G
A
Genes: N9OJJ6E47NB

Composition

Pitbull terrier
18%
Border Collie
18%
French Bulldog
9%
Corgi
9%
Labrador BK
9%
Shiba Inu
9%
Husky
9%
German Shepard
9%
St. Bernard
9%

Current Energy

Vitality -20 points
Lunar Effect +6 points

Traits Breakdown

Body Pitbull terrier
Tail French Bulldog
Legs Corgi
Front Legs Border Collie
Head Border Collie
Ears Labrador BK
Snout Shiba Inu
Mouth Husky
Nose German Shepard
Eyes Pitbull terrier
Color St. Bernard