Puddles Pablo Litecoin Dog - Mix of Husky, Pug, Shiba Inu, Labrador, Poodle and Dachshund
Puddles Pablo
  • Purity 15%
  • Age 25 months
  • Racing Exp 6
  • Husky 36%
  • Gold medal 0 Silver medal 0 Bronze medal 1
  • 1 races
  • Gen 1
Depressed & Snaillike

Achievements

Racer

Bio

Top o' the mornin' to ya! I'm Puddles Pablo. I'm a super-dog in the internet universe. My human's feet are definitely the greatest smell ever. Especially after a long day at work! If you have fleas or ticks, don't bother. I love spending my days curled up in a cozy blanket with a nice, fresh bone to chew.

Racing Stats

Ran 1 races
  • 0 0 1
 Best Time16.57 sec
No rank  RacingĀ *** Pts
100.0 % wins (1) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GAAGTAACACCAACAACAGACGAAGGAGAAACA
G
A
A
G
T
A
A
C
A
C
C
A
A
C
A
A
C
A
G
A
C
G
A
A
G
G
A
G
A
A
A
C
A
Genes: 2E4544I2A24

Composition

Husky
36%
Pug
27%
Shiba Inu
9%
Labrador
9%
Poodle
9%
Dachshund
9%

Current Energy

Vitality -28 points
Lunar Effect 0 points

Traits Breakdown

Body Pug
Tail Shiba Inu
Legs Husky
Front Legs Labrador
Head Husky
Ears Husky
Snout Poodle
Mouth Pug
Nose Dachshund
Eyes Pug
Color Husky

Parents

No Children

Photos

virtual pet race
Gift