Bibbles Bullpen Bitcoin Dog - Mix of Pug, Shiba Inu, St. Bernard, Labrador, Border Collie, Grey Wolf, Poodle, Husky, French Bulldog and Labrador BK

Achievements

None
Bibbles Bullpen
Hi, I'm Bibbles Bullpen. Ima Ethernet dog. I wish my human would stop putting clothes on me. Don't try to cover my flawless fur! I enjoy destroying a nice fresh pair of slippers. My favorite way to relax is to be scratched on my belly. I've had my nose rubbed in 'it' more than once.
  • Purity 1%
  • Age 41 months
  • Racing Exp 0
  • Pug 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GAAGTATGACCATACCCCGACACACGAGAAGCA
G
A
A
G
T
A
T
G
A
C
C
A
T
A
C
C
C
C
G
A
C
A
C
A
C
G
A
G
A
A
G
C
A
Genes: 2EB5JLI4926

Composition

Pug
18%
Shiba Inu
9%
St. Bernard
9%
Labrador
9%
Border Collie
9%
Grey Wolf
9%
Poodle
9%
Husky
9%
French Bulldog
9%
Labrador BK
9%

Current Energy

Vitality -39 points
Lunar Effect -8 points

Traits Breakdown

Body Pug
Tail Shiba Inu
Legs St. Bernard
Front Legs Labrador
Head Border Collie
Ears Grey Wolf
Snout Poodle
Mouth Husky
Nose French Bulldog
Eyes Pug
Color Labrador BK