Blake Bongo Bitcoin Dog - Mix of Grey Wolf, Beagle, Pitbull terrier, Shiba Inu, Labrador BK and Maltese

Achievements

None
Blake Bongo
I really enjoy squeaky toys! Well, I like ripping them apart and taking out the squeaker! I wish I never had to go to the vet's office. They are friendly enough, but it smells funny there. I'll lick anything. If you enjoy growling through fences as much as I do, we should get together.
  • Purity 18%
  • Age 28 months
  • Racing Exp 0
  • Grey Wolf 45%
  • 0 races
  • Gen 2
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CTATCCCTACCCGTACCCGCACCCCCCACCCCC
C
T
A
T
C
C
C
T
A
C
C
C
G
T
A
C
C
C
G
C
A
C
C
C
C
C
C
A
C
C
C
C
C
Genes: DNDLEL6LLKL

Composition

Grey Wolf
45%
Beagle
18%
Pitbull terrier
9%
Shiba Inu
9%
Labrador BK
9%
Maltese
9%

Current Energy

Vitality -44 points
Lunar Effect -8 points

Traits Breakdown

Body Beagle
Tail Pitbull terrier
Legs Beagle
Front Legs Grey Wolf
Head Shiba Inu
Ears Grey Wolf
Snout Labrador BK
Mouth Grey Wolf
Nose Grey Wolf
Eyes Maltese
Color Grey Wolf