Rider Rita Cryptocurrency Dog - Mix of Grey Wolf, Beagle, Labrador BK, Shiba Inu, Corgi, Maltese, German Shepard and French Bulldog

Achievements

None
Rider Rita
I'm a super-dog in the internet universe. I like shaking my fur next to humans right after a good swim! I don't understand why I like smelling butts... My favorite way to spend playtime is a good game of frisbee. I wish I never had to go to the vet's office. They are friendly enough, but it smells funny there.
  • Purity 8%
  • Age 28 months
  • Racing Exp 0
  • Grey Wolf 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCAGTACTACCCCCCAGCCCCCTAACCTCACGA
G
C
A
G
T
A
C
T
A
C
C
C
C
C
C
A
G
C
C
C
C
C
T
A
A
C
C
T
C
A
C
G
A
Genes: 6EDLLOLDK79

Composition

Grey Wolf
27%
Beagle
18%
Labrador BK
9%
Shiba Inu
9%
Corgi
9%
Maltese
9%
German Shepard
9%
French Bulldog
9%

Current Energy

Vitality -28 points
Lunar Effect -8 points

Traits Breakdown

Body Labrador BK
Tail Shiba Inu
Legs Beagle
Front Legs Grey Wolf
Head Grey Wolf
Ears Corgi
Snout Grey Wolf
Mouth Beagle
Nose Maltese
Eyes German Shepard
Color French Bulldog