Tiny Tidus Bitcoin Dog - Mix of Shiba Inu, Golder Retriever, Pug, Labrador BK, Rottweiler, French Bulldog, Pitbull terrier and Schnauzer

Achievements

Racer
Tiny Tidus
Virtually, I'll come whenever you call. My bark alone scares birds out of my yard. I hate it when my humans fart and they blame me! My favorite game is Fetch except I never bring the ball back. I need laid otherwise I'm going to start agreeing with Grumpy Cat.
  • Purity 6%
  • Age 31 months
  • Racing Exp 14
  • Shiba Inu 18%
  • 2 races
  • Gen 1
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 0 2 0
 Best Time15.23 sec
No rank  Racing *** Pts
100.0 % wins (2) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GTAGTAGCAAGACACCGAAGAGAATCCGAAATA
G
T
A
G
T
A
G
C
A
A
G
A
C
A
C
C
G
A
A
G
A
G
A
A
T
C
C
G
A
A
A
T
A
Genes: EE68H982N2C

Composition

Shiba Inu
18%
Golder Retriever
18%
Pug
18%
Labrador BK
9%
Rottweiler
9%
French Bulldog
9%
Pitbull terrier
9%
Schnauzer
9%

Current Energy

Vitality -29 points
Lunar Effect -6 points

Traits Breakdown

Body Shiba Inu
Tail Shiba Inu
Legs Labrador BK
Front Legs Golder Retriever
Head Rottweiler
Ears French Bulldog
Snout Golder Retriever
Mouth Pug
Nose Pitbull terrier
Eyes Pug
Color Schnauzer