Pip-Squeek Pooh-Bear Crypto Dog - Mix of Pug, Labrador, Shiba Inu, Labrador BK, Husky, Poodle, French Bulldog, St. Bernard, Border Collie and Grey Wolf

Achievements

None
Pip-Squeek Pooh-Bear
I'm an avid runner! Outside, inside, all over the place! I just want to run! Traipsing through mud puddles on to clean carpets...that's my favorite Saturday plan. I need laid otherwise I'm going to start agreeing with Grumpy Cat. You know the worst? Watching my humans 'get it on' when I've got no one.
  • Purity 1%
  • Age 41 months
  • Racing Exp 0
  • Pug 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCAGTAGCAACAGACCGATGAGAATACGAACCC
C
C
A
G
T
A
G
C
A
A
C
A
G
A
C
C
G
A
T
G
A
G
A
A
T
A
C
G
A
A
C
C
C
Genes: 5E64I9B2J2L

Composition

Pug
18%
Labrador
9%
Shiba Inu
9%
Labrador BK
9%
Husky
9%
Poodle
9%
French Bulldog
9%
St. Bernard
9%
Border Collie
9%
Grey Wolf
9%

Current Energy

Vitality -22 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador
Tail Shiba Inu
Legs Labrador BK
Front Legs Husky
Head Poodle
Ears French Bulldog
Snout St. Bernard
Mouth Pug
Nose Border Collie
Eyes Pug
Color Grey Wolf