Glass Joe Guile Bitcoin Dog - Mix of Golder Retriever, Poodle, Beagle, Pitbull terrier, Maltese, Shiba Inu, Dachshund and Rottweiler

Achievements

Racer
Glass Joe Guile
I'm into recreational spankings and a little 'ruff' play. Ultimate Frisbee is my favorite sport. I haven't really mastered the throwing part yet, but I have the catching part down! I hate never catching that damn rabbit in my dreams. Dragging my butt on the carpet feels so good.
  • Purity 11%
  • Age 37 months
  • Racing Exp 9
  • Golder Retriever 36%
  • 2 races
  • Gen 1
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 1 0 0
 Best Time15.07 sec
No rank  Racing *** Pts
50.0 % wins (1) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GACAGACTATCCAGAACCGTAGGACACAGAAGA
G
A
C
A
G
A
C
T
A
T
C
C
A
G
A
A
C
C
G
T
A
G
G
A
C
A
C
A
G
A
A
G
A
Genes: I8DN8KEAH88

Composition

Golder Retriever
36%
Poodle
9%
Beagle
9%
Pitbull terrier
9%
Maltese
9%
Shiba Inu
9%
Dachshund
9%
Rottweiler
9%

Current Energy

Vitality -61 points
Lunar Effect -10 points

Traits Breakdown

Body Poodle
Tail Golder Retriever
Legs Beagle
Front Legs Pitbull terrier
Head Golder Retriever
Ears Maltese
Snout Shiba Inu
Mouth Dachshund
Nose Rottweiler
Eyes Golder Retriever
Color Golder Retriever