Maximus Meadow Digital Cryptocurrency Dog - Mix of Golder Retriever, Pitbull terrier, Grey Wolf, Shiba Inu, Dachshund and Rottweiler

Achievements

Racer
Maximus Meadow
As a good digital dog, my humans give me virtually everything. If I can't reach it to clean it myself, it doesn't need cleaning! I love barking all night when others try to sleep. I hate when my human pretends to throw the ball, but then magically has it behind their back when I go looking for it. It's some kind of sorcery!
  • Purity 17%
  • Age 41 months
  • Racing Exp 22
  • Golder Retriever 36%
  • 11 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 1 1
11 races    Best Time14.95 sec
No rank  Racing *** Coins
18.2 % wins (2) Breeding *** Coins
Scheduled races 1 Total *** Coins

DNA Analysis

DNA Sequence: CCCAGATCCTCCAGATCCGTAGGACACAGAAGA
C
C
C
A
G
A
T
C
C
T
C
C
A
G
A
T
C
C
G
T
A
G
G
A
C
A
C
A
G
A
A
G
A
Genes: L8NN8NEAH88

Composition

Golder Retriever
36%
Pitbull terrier
27%
Grey Wolf
9%
Shiba Inu
9%
Dachshund
9%
Rottweiler
9%

Current Energy

Vitality -41 points
Lunar Effect -18 points

Traits Breakdown

Body Grey Wolf
Tail Golder Retriever
Legs Pitbull terrier
Front Legs Pitbull terrier
Head Golder Retriever
Ears Pitbull terrier
Snout Shiba Inu
Mouth Dachshund
Nose Rottweiler
Eyes Golder Retriever
Color Golder Retriever