Bubba Beatrice Litecoin Game Dog - Mix of Yorkshire Terrier, Grey Wolf and Rottweiler

Achievements

None
Bubba Beatrice
I'm an avid runner! Outside, inside, all over the place! I just want to run! I wish my human would stop putting clothes on me. Don't try to cover my flawless fur! I love car rides when I can stick my head out the window. I'm looking for someone smart enough to help me find the treat stash.
  • Purity 65%
  • Age 40 months
  • Racing Exp 0
  • Yorkshire Terrier 82%
  • 0 races
  • Gen 3
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TTATTATTATTACCCTTATTACACTTATTATTA
T
T
A
T
T
A
T
T
A
T
T
A
C
C
C
T
T
A
T
T
A
C
A
C
T
T
A
T
T
A
T
T
A
Genes: FFFFLFFHFFF

Composition

Yorkshire Terrier
82%
Grey Wolf
9%
Rottweiler
9%

Current Energy

Vitality -39 points
Lunar Effect -4 points

Traits Breakdown

Body Yorkshire Terrier
Tail Yorkshire Terrier
Legs Yorkshire Terrier
Front Legs Yorkshire Terrier
Head Grey Wolf
Ears Yorkshire Terrier
Snout Yorkshire Terrier
Mouth Rottweiler
Nose Yorkshire Terrier
Eyes Yorkshire Terrier
Color Yorkshire Terrier