K-9 Keesha Digital Cryptocurrency Game Dog - Mix of French Bulldog, Pitbull terrier, Yorkshire Terrier, Pug, Poodle, Grey Wolf, Schnauzer, Boxer, Rottweiler and Labrador BK

Achievements

None
K-9 Keesha
A-yo...Call me K-9 Keesha. I've been known to take mega bytes when playing ruff. I hate never catching that damn rabbit in my dreams. I'm going kill that damn Nyan Cat if I can catch it. I love cuddling up, doggy-style after a romantic evening. What's your favorite bed? Mine is the dirty laundry.
  • Purity 3%
  • Age 38 months
  • Racing Exp 0
  • French Bulldog 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCCTTAGAAGACCCCATAAACCACGCACGACGA
T
C
C
T
T
A
G
A
A
G
A
C
C
C
C
A
T
A
A
A
C
C
A
C
G
C
A
C
G
A
C
G
A
Genes: NF2ILCGH699

Composition

French Bulldog
18%
Pitbull terrier
9%
Yorkshire Terrier
9%
Pug
9%
Poodle
9%
Grey Wolf
9%
Schnauzer
9%
Boxer
9%
Rottweiler
9%
Labrador BK
9%

Current Energy

Vitality -55 points
Lunar Effect -2 points

Traits Breakdown

Body Pitbull terrier
Tail Yorkshire Terrier
Legs Pug
Front Legs Poodle
Head Grey Wolf
Ears Schnauzer
Snout Boxer
Mouth Rottweiler
Nose Labrador BK
Eyes French Bulldog
Color French Bulldog