Kibbles Knuckles Crypto Game Dog - Mix of St. Bernard, Rottweiler, Border Collie, Schnauzer, Maltese, Pug, Shiba Inu and German Shepard

Achievements

Racer
Kibbles Knuckles
I hate it when other dogs pee in my yard! IT'S MY YARD!! I don't mind sharing my bed with someone I just met, if we can cuddle. What's your favorite bed? Mine is the dirty laundry. Size doesn't matter, I like 'em all.
  • Purity 6%
  • Age 40 months
  • Racing Exp 7
  • St. Bernard 27%
  • 2 races
  • Gen 1
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 1
2 races    Best Time16.00 sec
No rank  Racing *** Coins
50.0 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACTGACACATATGAACCGAAGTACACTCATGA
T
A
C
T
G
A
C
A
C
A
T
A
T
G
A
A
C
C
G
A
A
G
T
A
C
A
C
T
C
A
T
G
A
Genes: JBHCBK2EH7B

Composition

St. Bernard
27%
Rottweiler
18%
Border Collie
9%
Schnauzer
9%
Maltese
9%
Pug
9%
Shiba Inu
9%
German Shepard
9%

Current Energy

Vitality -44 points
Lunar Effect +8 points

Traits Breakdown

Body Border Collie
Tail St. Bernard
Legs Rottweiler
Front Legs Schnauzer
Head St. Bernard
Ears Maltese
Snout Pug
Mouth Shiba Inu
Nose Rottweiler
Eyes German Shepard
Color St. Bernard