Hamlet Helmet Litecoin Dog - Mix of St. Bernard, German Shepard, Pitbull terrier, Border Collie, Maltese and Shiba Inu

Achievements

Racer
Hamlet Helmet
As a good digital dog, my humans give me virtually everything. I hate it when humans put the lid down. Spiked dog collars really turn me on. I am a proud show dog. I like showing off my perfect coat! Little Bow Wow is my favorite musician. I just assume he's a dog...
  • Purity 12%
  • Age 40 months
  • Racing Exp 2
  • St. Bernard 36%
  • 2 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
2 races    Best Time15.32 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACTGATCATCCTGAACCTGAGTATCCTCATGA
T
A
C
T
G
A
T
C
A
T
C
C
T
G
A
A
C
C
T
G
A
G
T
A
T
C
C
T
C
A
T
G
A
Genes: JB7NBKBEN7B

Composition

St. Bernard
36%
German Shepard
18%
Pitbull terrier
18%
Border Collie
9%
Maltese
9%
Shiba Inu
9%

Current Energy

Vitality -31 points
Lunar Effect +14 points

Traits Breakdown

Body Border Collie
Tail St. Bernard
Legs German Shepard
Front Legs Pitbull terrier
Head St. Bernard
Ears Maltese
Snout St. Bernard
Mouth Shiba Inu
Nose Pitbull terrier
Eyes German Shepard
Color St. Bernard