Maddy Mister Miyagi Crypto Dog - Mix of Shiba Inu, Labrador BK, Beagle, Husky, Border Collie, Maltese, Pug, Labrador and Yorkshire Terrier

Achievements

None
Maddy Mister Miyagi
Barkjour mi amor! I'm Maddy Mister Miyagi. I am a guard dog for the data warehouse. If I can't reach it to clean it myself, it doesn't need cleaning! Slipping my collar, running off and making my humans worried? Every chance I get. I want to find that special friend who enjoys sharing each other's doggie bags.
  • Purity 3%
  • Age 38 months
  • Racing Exp 0
  • Shiba Inu 18%
  • 0 races
  • Gen 2
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CTAGTAACATACACCGAAGCACCATTAGCAGTA
C
T
A
G
T
A
A
C
A
T
A
C
A
C
C
G
A
A
G
C
A
C
C
A
T
T
A
G
C
A
G
T
A
Genes: DE4JK265F6E

Composition

Shiba Inu
18%
Labrador BK
18%
Beagle
9%
Husky
9%
Border Collie
9%
Maltese
9%
Pug
9%
Labrador
9%
Yorkshire Terrier
9%

Current Energy

Vitality -33 points
Lunar Effect +4 points

Traits Breakdown

Body Beagle
Tail Shiba Inu
Legs Husky
Front Legs Border Collie
Head Maltese
Ears Pug
Snout Labrador BK
Mouth Labrador
Nose Yorkshire Terrier
Eyes Labrador BK
Color Shiba Inu

Parents

No Children