Toby Tinker Bitcoin Game Dog - Mix of Poodle, Shiba Inu, French Bulldog, Border Collie, Grey Wolf, Pug, Labrador BK, Golder Retriever, German Shepard and Labrador

Achievements

Racer
Toby Tinker
Suh? How's it goin? I'm Toby Tinker. As a digital dog, let me say Bob Dole did not invent the internet. Long or short hair works for me, just no baldies please. I'll outrun you for the ball if I can...that's just how I roll. Steak is my absolute favorite, but I prefer to eat chicken for my health.
  • Purity 1%
  • Age 40 months
  • Racing Exp 6
  • Poodle 18%
  • 1 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 1
1 races    Best Time16.00 sec
No rank  Racing *** Coins
100.0 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GACGTACGATACCCCGAAGCAGACAGATCACCA
G
A
C
G
T
A
C
G
A
T
A
C
C
C
C
G
A
A
G
C
A
G
A
C
A
G
A
T
C
A
C
C
A
Genes: IE9JL26I875

Composition

Poodle
18%
Shiba Inu
9%
French Bulldog
9%
Border Collie
9%
Grey Wolf
9%
Pug
9%
Labrador BK
9%
Golder Retriever
9%
German Shepard
9%
Labrador
9%

Current Energy

Vitality -38 points
Lunar Effect -18 points

Traits Breakdown

Body Poodle
Tail Shiba Inu
Legs French Bulldog
Front Legs Border Collie
Head Grey Wolf
Ears Pug
Snout Labrador BK
Mouth Poodle
Nose Golder Retriever
Eyes German Shepard
Color Labrador