Hannibal Harvey Bitcoin Dog - Mix of German Shepard, Boxer, Labrador, Border Collie, Grey Wolf, Pitbull terrier, Rottweiler, Beagle, St. Bernard and Dachshund

Achievements

None
Hannibal Harvey
I like exploring off leash best. My favorite chews are underwear and rawhide...the rawhide lasts longer. I love it when you show a little teeth. I hate it when humans put the lid down. I'm trying to find a partner in crime to help me dig through the trash for the good stuff.
  • Purity 1%
  • Age 32 days
  • Racing Exp 0
  • German Shepard 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AACCCATCATACCCCTCATCCCACCTATGAGGA
A
A
C
C
C
A
T
C
A
T
A
C
C
C
C
T
C
A
T
C
C
C
A
C
C
T
A
T
G
A
G
G
A
Genes: G57JL7NHDBA

Composition

German Shepard
18%
Boxer
9%
Labrador
9%
Border Collie
9%
Grey Wolf
9%
Pitbull terrier
9%
Rottweiler
9%
Beagle
9%
St. Bernard
9%
Dachshund
9%

Current Energy

Vitality +37 points
Lunar Effect -4 points

Traits Breakdown

Body Boxer
Tail Labrador
Legs German Shepard
Front Legs Border Collie
Head Grey Wolf
Ears German Shepard
Snout Pitbull terrier
Mouth Rottweiler
Nose Beagle
Eyes St. Bernard
Color Dachshund