Relay Reggie Crypto Game Dog - Mix of Border Collie, Pug, Husky, Maltese, German Shepard, Grey Wolf, Labrador and Yorkshire Terrier

Achievements

Racer
Podium Champion
Relay Reggie
How do you do? I'm Relay Reggie. My 'G' spot is under my chin...scratch me there and I'll growl softly. I enjoy trying to be friends with the neighbor's cats. They still run away from me but they'll grow to love me one day! You know the worst? Watching my humans 'get it on' and I have to lick myself.
  • Purity 4%
  • Age 41 months
  • Racing Exp 37
  • Border Collie 18%
  • 7 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 1 3 1
7 races    Best Time16.03 sec
No rank  Racing *** Coins
71.4 % wins (5) Breeding *** Coins
Scheduled races 1 Total *** Coins

DNA Analysis

DNA Sequence: ACCTACGAATCACCCGAAACATACCCAACATTA
A
C
C
T
A
C
G
A
A
T
C
A
C
C
C
G
A
A
A
C
A
T
A
C
C
C
A
A
C
A
T
T
A
Genes: KJ27L24J54F

Composition

Border Collie
18%
Pug
18%
Husky
18%
Maltese
9%
German Shepard
9%
Grey Wolf
9%
Labrador
9%
Yorkshire Terrier
9%

Current Energy

Vitality -44 points
Lunar Effect 0 points

Traits Breakdown

Body Maltese
Tail Border Collie
Legs Pug
Front Legs German Shepard
Head Grey Wolf
Ears Pug
Snout Husky
Mouth Border Collie
Nose Labrador
Eyes Husky
Color Yorkshire Terrier