Esme Eloise Bitcoin Game Dog - Mix of Border Collie, Husky, Shiba Inu, Golder Retriever, Grey Wolf, Labrador, French Bulldog, Poodle, Corgi and Labrador BK

Achievements

None
Esme Eloise
Power outages and computer viruses scare me! The absolute best time of day is dinner time! I'm into chasing fast cars, squirrels and my tail. I've had my nose rubbed in 'it' more than once. I'm looking to share time together and not just to be an accessory.
  • Purity 1%
  • Age 31 days
  • Racing Exp 0
  • Border Collie 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACAGTATACAGACCCCCATACCGAGACAGCGCA
A
C
A
G
T
A
T
A
C
A
G
A
C
C
C
C
C
A
T
A
C
C
G
A
G
A
C
A
G
C
G
C
A
Genes: 4EJ8L5J9IO6

Composition

Border Collie
18%
Husky
9%
Shiba Inu
9%
Golder Retriever
9%
Grey Wolf
9%
Labrador
9%
French Bulldog
9%
Poodle
9%
Corgi
9%
Labrador BK
9%

Current Energy

Vitality +47 points
Lunar Effect -16 points

Traits Breakdown

Body Husky
Tail Shiba Inu
Legs Border Collie
Front Legs Golder Retriever
Head Grey Wolf
Ears Labrador
Snout Border Collie
Mouth French Bulldog
Nose Poodle
Eyes Corgi
Color Labrador BK