Luke Skywalker Lolita Bitcoin Dog - Mix of Corgi, Labrador, Grey Wolf, Golder Retriever, German Shepard, Pug, Border Collie and Poodle

Achievements

Racer
Luke Skywalker Lolita
My name is Luke Skywalker Lolita and I'd really like to sniff you. I love hiding my human's shoes. I have a pretty nice collection of old, stinky sneakers. My favorite place in the world is the dog park. So many smells! I'm on the lookout for someone willing to stop and smell the catpoop with me.
  • Purity 8%
  • Age 29 days
  • Racing Exp 1
  • Corgi 27%
  • 1 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 0 0
 Best Time18.05 sec
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCCAGATCAGAACCAAGCAGCTACCCAGACAGC
C
C
C
A
G
A
T
C
A
G
A
A
C
C
A
A
G
C
A
G
C
T
A
C
C
C
A
G
A
C
A
G
C
Genes: L8725OOJ5IO

Composition

Corgi
27%
Labrador
18%
Grey Wolf
9%
Golder Retriever
9%
German Shepard
9%
Pug
9%
Border Collie
9%
Poodle
9%

Current Energy

Vitality +28 points
Lunar Effect -12 points

Traits Breakdown

Body Grey Wolf
Tail Golder Retriever
Legs German Shepard
Front Legs Pug
Head Labrador
Ears Corgi
Snout Corgi
Mouth Border Collie
Nose Labrador
Eyes Poodle
Color Corgi

Parents

No Children

Photos