Bayleaf Bane Litecoin Dog - Mix of Pitbull terrier, Shiba Inu, Grey Wolf, Corgi, Rottweiler, Labrador BK, Golder Retriever, Yorkshire Terrier and French Bulldog

Achievements

Racer
Bayleaf Bane
Size matters. This dawg's into big databases. I love waking up early then indulging in long afternoon naps. I really dislike stinky flea collars. I'm always up for some puppy action, is that wrong? New experiences? New treats? New places! Yes, please!
  • Purity 3%
  • Age 32 days
  • Racing Exp 7
  • Pitbull terrier 18%
  • 1 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 1 0
 Best Time15.88 sec
No rank  Racing *** Pts
100.0 % wins (1) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCCCCCAGCCACTCCGCAGTAAGAGTATTACGA
T
C
C
C
C
C
A
G
C
C
A
C
T
C
C
G
C
A
G
T
A
A
G
A
G
T
A
T
T
A
C
G
A
Genes: NLOHN6E8EF9

Composition

Pitbull terrier
18%
Shiba Inu
18%
Grey Wolf
9%
Corgi
9%
Rottweiler
9%
Labrador BK
9%
Golder Retriever
9%
Yorkshire Terrier
9%
French Bulldog
9%

Current Energy

Vitality +9 points
Lunar Effect -12 points

Traits Breakdown

Body Pitbull terrier
Tail Grey Wolf
Legs Corgi
Front Legs Rottweiler
Head Pitbull terrier
Ears Labrador BK
Snout Shiba Inu
Mouth Golder Retriever
Nose Shiba Inu
Eyes Yorkshire Terrier
Color French Bulldog

Parents

No Children

Photos

Litecoin pet race