Friday Foxy Bitcoin Dog - Mix of Dachshund, Poodle, Pitbull terrier, Schnauzer, Corgi, Rottweiler, Labrador BK, Husky and French Bulldog

Achievements

Racer
Friday Foxy
Hi, I'm Friday Foxy. I've been known to take mega bytes when playing ruff. I have an ongoing battle with the vacuum cleaner. It's loud and it steals all the food crumbs I was saving for later! I'm not usually indecisive. But a new bone, a new slipper...so hard to decide!
  • Purity 5%
  • Age 31 days
  • Racing Exp 7
  • Dachshund 18%
  • 1 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 1 0
 Best Time15.88 sec
No rank  Racing *** Pts
100.0 % wins (1) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GGATCCATAAGCGGACACGCAACAGACGACCGA
G
G
A
T
C
C
A
T
A
A
G
C
G
G
A
C
A
C
G
C
A
A
C
A
G
A
C
G
A
C
C
G
A
Genes: ANCOAH64II9

Composition

Dachshund
18%
Poodle
18%
Pitbull terrier
9%
Schnauzer
9%
Corgi
9%
Rottweiler
9%
Labrador BK
9%
Husky
9%
French Bulldog
9%

Current Energy

Vitality +4 points
Lunar Effect -12 points

Traits Breakdown

Body Dachshund
Tail Pitbull terrier
Legs Schnauzer
Front Legs Corgi
Head Dachshund
Ears Rottweiler
Snout Labrador BK
Mouth Husky
Nose Poodle
Eyes Poodle
Color French Bulldog