Burger Bond Litecoin Dog - Mix of Schnauzer, Poodle, Maltese, Boxer, Pitbull terrier, Rottweiler and Grey Wolf

Achievements

Racer
Burger Bond
Nice to meet you! I'm Burger Bond. I think swimming is pretty much the most fun thing ever. Pools, lakes, ponds, even slightly large puddles on the sidewalk! Those Elizabethan cone collars are awful! You gotta lick when you gotta lick, am I right? I'm looking for someone who is also playful, feisty and happy.
  • Purity 13%
  • Age 31 days
  • Racing Exp 6
  • Schnauzer 27%
  • 1 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 0 1
 Best Time16.95 sec
No rank  Racing *** Pts
100.0 % wins (1) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AACTCCGACGACACCATAATAATAACCCACCCC
A
A
C
T
C
C
G
A
C
G
A
C
A
C
C
A
T
A
A
T
A
A
T
A
A
C
C
C
A
C
C
C
C
Genes: GNIIKCCCKHL

Composition

Schnauzer
27%
Poodle
18%
Maltese
18%
Boxer
9%
Pitbull terrier
9%
Rottweiler
9%
Grey Wolf
9%

Current Energy

Vitality +4 points
Lunar Effect +4 points

Traits Breakdown

Body Boxer
Tail Pitbull terrier
Legs Poodle
Front Legs Poodle
Head Maltese
Ears Schnauzer
Snout Schnauzer
Mouth Schnauzer
Nose Maltese
Eyes Rottweiler
Color Grey Wolf

Parents

No Children

Photos

Litecoin pet race