Macgyver Mason Litecoin Game Dog - Mix of St. Bernard, Pug, Corgi, Beagle, Shiba Inu, Pitbull terrier, Rottweiler and Poodle

Achievements

Racer
Macgyver Mason
They call me Macgyver Mason. What's your name? I work in The Virtual Machine. Those Elizabethan cone collars are awful! You gotta lick when you gotta lick, am I right? I would like to find someone that really appreciates the finer things in life: stinky socks, old tennis balls, toilet water, etc...
  • Purity 4%
  • Age 29 days
  • Racing Exp 8
  • St. Bernard 18%
  • 1 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 1 0 0
 Best Time16.78 sec
No rank  Racing *** Pts
100.0 % wins (1) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CTAGTATCCTGACACGAAAGCGACAGCTGAGAA
C
T
A
G
T
A
T
C
C
T
G
A
C
A
C
G
A
A
A
G
C
G
A
C
A
G
C
T
G
A
G
A
A
Genes: DENBH2OIOB2

Composition

St. Bernard
18%
Pug
18%
Corgi
18%
Beagle
9%
Shiba Inu
9%
Pitbull terrier
9%
Rottweiler
9%
Poodle
9%

Current Energy

Vitality +17 points
Lunar Effect -4 points

Traits Breakdown

Body Beagle
Tail Shiba Inu
Legs Pitbull terrier
Front Legs St. Bernard
Head Rottweiler
Ears Pug
Snout Corgi
Mouth Poodle
Nose Corgi
Eyes St. Bernard
Color Pug

Parents

No Children

Photos

Litecoin pet race podium