Macgyver Mason Litecoin Game Dog - Mix of St. Bernard, Pug, Corgi, Beagle, Shiba Inu, Pitbull terrier, Rottweiler and Poodle

Achievements

Racer
Macgyver Mason
They call me Macgyver Mason. What's your name? I work in The Virtual Machine. Those Elizabethan cone collars are awful! You gotta lick when you gotta lick, am I right? I would like to find someone that really appreciates the finer things in life: stinky socks, old tennis balls, toilet water, etc...
  • Purity 4%
  • Age 3 months
  • Racing Exp 8
  • St. Bernard 18%
  • 1 races
  • Gen 0
Share it to make him Happy!
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

  • 1 0 0
1 races    Best Time16.78 sec
No rank  Racing *** Coins
100.0 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CTAGTATCCTGACACGAAAGCGACAGCTGAGAA
C
T
A
G
T
A
T
C
C
T
G
A
C
A
C
G
A
A
A
G
C
G
A
C
A
G
C
T
G
A
G
A
A
Genes: DENBH2OIOB2

Composition

St. Bernard
18%
Pug
18%
Corgi
18%
Beagle
9%
Shiba Inu
9%
Pitbull terrier
9%
Rottweiler
9%
Poodle
9%

Current Energy

Vitality -30 points
Lunar Effect +2 points

Traits Breakdown

Body Beagle
Tail Shiba Inu
Legs Pitbull terrier
Front Legs St. Bernard
Head Rottweiler
Ears Pug
Snout Corgi
Mouth Poodle
Nose Corgi
Eyes St. Bernard
Color Pug