Waluigi Wilber Bitcoin Game Dog - Mix of Pug, Shiba Inu, Maltese, Border Collie, Corgi, Pitbull terrier, Yorkshire Terrier and Dachshund

Achievements

Racer
Waluigi Wilber
I'm terrified of the big, loud, metal creature with people inside that picks up the trash every week. It's really scary! I'll outrun you for the ball if I can...that's just how I roll. Size doesn't matter, I like 'em all. I've been solitary dog...looking for someone worth changing over.
  • Purity 6%
  • Age 39 months
  • Racing Exp 1
  • Pug 18%
  • 1 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 0 0
 Best Time17.38 sec
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GAAGTATACGTAACCACCAGCTCCTTAGAAGGA
G
A
A
G
T
A
T
A
C
G
T
A
A
C
C
A
C
C
A
G
C
T
C
C
T
T
A
G
A
A
G
G
A
Genes: 2EJEKKONF2A

Composition

Pug
18%
Shiba Inu
18%
Maltese
18%
Border Collie
9%
Corgi
9%
Pitbull terrier
9%
Yorkshire Terrier
9%
Dachshund
9%

Current Energy

Vitality -45 points
Lunar Effect +2 points

Traits Breakdown

Body Pug
Tail Shiba Inu
Legs Border Collie
Front Legs Shiba Inu
Head Maltese
Ears Maltese
Snout Corgi
Mouth Pitbull terrier
Nose Yorkshire Terrier
Eyes Pug
Color Dachshund

Parents

No Children

Photos