Amy Aiden Crypto Dog - Mix of Labrador BK, St. Bernard, Husky, Schnauzer, Yorkshire Terrier, Corgi and Labrador

Achievements

Racer
Amy Aiden
I answer to 'Amy Aiden'. Blue toilet water turns me off. I'm not usually indecisive. But a new bone, a new slipper...so hard to decide! My 'G' spot is under my chin...scratch me there and I'll growl softly. If you are looking for companionship without commitment, so am I.
  • Purity 7%
  • Age 3 months
  • Racing Exp 8
  • Labrador BK 27%
  • 1 races
  • Gen 0
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

  • 1 0 0
1 races    Best Time15.68 sec
No rank  Racing *** Coins
100.0 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TGAATATGATTAACAGCAAGCGCAACACCAGCA
T
G
A
A
T
A
T
G
A
T
T
A
A
C
A
G
C
A
A
G
C
G
C
A
A
C
A
C
C
A
G
C
A
Genes: BCBF46O6456

Composition

Labrador BK
27%
St. Bernard
18%
Husky
18%
Schnauzer
9%
Yorkshire Terrier
9%
Corgi
9%
Labrador
9%

Current Energy

Vitality -34 points
Lunar Effect +16 points

Traits Breakdown

Body St. Bernard
Tail Schnauzer
Legs St. Bernard
Front Legs Yorkshire Terrier
Head Husky
Ears Labrador BK
Snout Corgi
Mouth Labrador BK
Nose Husky
Eyes Labrador
Color Labrador BK

Parents

Children

Photos

Bitcoin dog racing